View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_high_43 (Length: 250)
Name: NF13133_high_43
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 43986793 - 43987024
Alignment:
| Q |
1 |
agttaggaataatggaaccatggtctttaatttcgttgaggaaaattgaaattatagtaatttgacgtatagtttctcttgcgttacgtttttgtgttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43986793 |
agttaggaataatggaaccatggtctttaatttcgttgaggaaaattgaaattatagtaatttgacgtatagtttctcttgcgttacgtttttgtgttgg |
43986892 |
T |
 |
| Q |
101 |
gaatatttgaggttggaaattggatatagtttgtgaaagattgattagagaagtgatgagtgttgtgggagatatgttttcgcaagggtgaaccgccggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43986893 |
gaatatttgaggttggaaattggatatagtttgtgaaagattgattagagaagtgatgagtgttgtgggagatatgttttcgcaagggtgaaccgccggg |
43986992 |
T |
 |
| Q |
201 |
aatgataggatacggcgatccctttgattagt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43986993 |
aatgataggatacggcgatccctttgattagt |
43987024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University