View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_high_48 (Length: 237)
Name: NF13133_high_48
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_high_48 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 123 - 237
Target Start/End: Complemental strand, 32361440 - 32361326
Alignment:
| Q |
123 |
aagagaaactactcattttcattcccatcaatttttacattatttttcagattatcactttnnnnnnntagttatcaaaaatagttttcaatttagtcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
32361440 |
aagagaaactactcattttcattcccatcaatttttacattatctttcagattatcactttaaaaaaatagttataaaaaatagttttcaatttagtcat |
32361341 |
T |
|
| Q |
223 |
tatgcaacattatat |
237 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
32361340 |
tatgcaacatcatat |
32361326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 135
Target Start/End: Complemental strand, 30337775 - 30337742
Alignment:
| Q |
102 |
tagttatcaaaaacgattttcaagagaaactact |
135 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
30337775 |
tagttatcaaaaatgattttcaagagaaactact |
30337742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University