View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13133_high_48 (Length: 237)

Name: NF13133_high_48
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13133_high_48
NF13133_high_48
[»] chr5 (1 HSPs)
chr5 (123-237)||(32361326-32361440)
[»] chr4 (1 HSPs)
chr4 (102-135)||(30337742-30337775)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 123 - 237
Target Start/End: Complemental strand, 32361440 - 32361326
Alignment:
123 aagagaaactactcattttcattcccatcaatttttacattatttttcagattatcactttnnnnnnntagttatcaaaaatagttttcaatttagtcat 222  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||       ||||||| ||||||||||||||||||||||||    
32361440 aagagaaactactcattttcattcccatcaatttttacattatctttcagattatcactttaaaaaaatagttataaaaaatagttttcaatttagtcat 32361341  T
223 tatgcaacattatat 237  Q
    |||||||||| ||||    
32361340 tatgcaacatcatat 32361326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 135
Target Start/End: Complemental strand, 30337775 - 30337742
Alignment:
102 tagttatcaaaaacgattttcaagagaaactact 135  Q
    ||||||||||||| ||||||||||||||||||||    
30337775 tagttatcaaaaatgattttcaagagaaactact 30337742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University