View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_low_23 (Length: 415)
Name: NF13133_low_23
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 226 - 397
Target Start/End: Complemental strand, 4349892 - 4349722
Alignment:
| Q |
226 |
aacacatgttgttatagcatatgaaagtaagatgacaaaaggtagtgctacttttaagagagaaaaaggaaataatagtgaactattttcaattattgaa |
325 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4349892 |
aacatatgttgttatagcatatgaaagtaagatgacaaaaggtagtgcgacttttaagagagaaaaaggaaataatagtgaactatttgcaattattgaa |
4349793 |
T |
|
| Q |
326 |
ctccttagataattcgtttgatttcctgagtcaaggtatgtaacacttattatttagttctagtacaacaac |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4349792 |
ctccttagataattcgtttgatttcctgagtc-aggtatgtaacacttattatttagttctagtacaacaac |
4349722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University