View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_low_34 (Length: 307)
Name: NF13133_low_34
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 21 - 178
Target Start/End: Complemental strand, 42833050 - 42832893
Alignment:
| Q |
21 |
gcactgctggattacccttctttaaaactattcattccgttttttgtaatatgcccttaattctgcgtggtagatcaacttagaatannnnnnnngtgag |
120 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42833050 |
gcactgctggagtacccttctttaaaactattcattccgttttttgtaatgtgcccttaattctgcgtggtagatcaacttagaatatttttgttgtgag |
42832951 |
T |
 |
| Q |
121 |
gtcaattgctctattttttggtgtttttaagatatcaagattcaagacaccagaaagg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
42832950 |
gtcaattgctctattttttggtgtttttgagatatcaagattcaagacaacagaaagg |
42832893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 174 - 293
Target Start/End: Complemental strand, 42832620 - 42832501
Alignment:
| Q |
174 |
aaaggaatgtttgttatattagagatgcttgtaatttaaaatgttcaatttcaatgtcgaacccgtttctctaattttcttcgtttgtaattgtctagtc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42832620 |
aaaggaatgtttgttatattagagatgcttgtaatttaaaatgttcaatttcaatgtcgaacccgtttctctaattttcttcgtttgtaattgtctaatc |
42832521 |
T |
 |
| Q |
274 |
gaaaaagaaatattcaaatt |
293 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
42832520 |
gaaaaagaaatattcgaatt |
42832501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University