View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_low_35 (Length: 302)
Name: NF13133_low_35
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 14 - 288
Target Start/End: Complemental strand, 10128489 - 10128217
Alignment:
| Q |
14 |
aggatgtcaaagtgaagtttctgttactatttggtaacaataacgaatagcaaagttgttatgatccattaatttcttacaatctagtaataataggtaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10128489 |
aggatgtcaaagtgaagtttctgttactatttggta-caataacgaatagcaaagttgttagtatccattaatttcttacaatctagtaataataggtaa |
10128391 |
T |
|
| Q |
114 |
tttagtcttatattttatgtataaatcgcgtagagtactaagatacaatccattatgttgatttgattccgaaatcgtgttgagtactaagcagctcagc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10128390 |
tttagtcttatattttatgtataaatcgcgtagagtactaagatacaatccattatgttgattcgattccgaaatcgtgttgagtactaagcagctcagc |
10128291 |
T |
|
| Q |
214 |
tagaattagatttaacttgatagatagtgcttcattgtatagttatggaatgaaacgttcacacccaaagttctg |
288 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
10128290 |
tagaatgagatttaacttgatagatagtgcttcattgtatggttatggaatgaaacgttcaca-ccaaagttctg |
10128217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 288
Target Start/End: Complemental strand, 40777199 - 40777107
Alignment:
| Q |
195 |
gagtactaagcagctcagctagaattagatttaacttgatagatagtgcttcattgtatagttatggaatgaaacgttcacacccaaagttctg |
288 |
Q |
| |
|
||||||||||||| |||||||||||| | || ||| | || ||||||||||| |||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
40777199 |
gagtactaagcagttcagctagaattggcttaaaccttatggatagtgcttccttgtatggttatggaatgaagcgttcaca-ccaaagttctg |
40777107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 204 - 278
Target Start/End: Complemental strand, 40764562 - 40764490
Alignment:
| Q |
204 |
gcagctcagctagaattagatttaacttgatagatagtgcttcattgtatagttatggaatgaaacgttcacacc |
278 |
Q |
| |
|
||||||| | |||||| ||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||| |
|
|
| T |
40764562 |
gcagctcggttagaataggatttaacttgatagatagtgtttcattgtata--tatgaaatgaaacgttcacacc |
40764490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University