View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_low_37 (Length: 291)
Name: NF13133_low_37
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 15 - 270
Target Start/End: Complemental strand, 31534375 - 31534122
Alignment:
| Q |
15 |
acaaacatgtcatgtaggcacacaattacgcgcaagtaacacataaagtggttaaagtaaaagtcaatttaaaaaggacactggattgagctatatcact |
114 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31534375 |
acaaacatgtcatgtaggcacgcaattaagcgtaagtaacacataaagtggttaaagtaaaagtcaatttaaaaaggacactggattgagctatatcact |
31534276 |
T |
|
| Q |
115 |
agcggtttaannnnnnnnnnnnnataacaactattattttgcatctccatttttcttttcacacccctttatatttggaatttacttttcttaaatacct |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31534275 |
agcggtttaatttttcttttt--ataacaactattattttgcatctccatttttcttttcacacccctttatatttggaatttacttttcttaaatacct |
31534178 |
T |
|
| Q |
215 |
tcactccttatcccaatcttaaacctagccccctatcatgtcattcttatagagta |
270 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31534177 |
tcactcgttatcccaatcttaaacctagccccctatcatgtcattcttatagagta |
31534122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University