View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_low_39 (Length: 275)
Name: NF13133_low_39
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 143 - 273
Target Start/End: Complemental strand, 35473243 - 35473113
Alignment:
| Q |
143 |
ccggagagtatatgctttttaatcccagcttgaagatgaaattattagaaggaggataaaccaaagctttggaatacaatccgcaagttgaagatatggg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473243 |
ccggagagtatatgctttttaatcccagcttgaagatgaaattatgagaacgaggacaaaccaaagctttggaatacaatccgcaagttgaagatatggg |
35473144 |
T |
 |
| Q |
243 |
aagatgaaatagattttgttgtaacttttct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35473143 |
aagatgaaatagattttgttgtaacttttct |
35473113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 11 - 92
Target Start/End: Complemental strand, 35473325 - 35473244
Alignment:
| Q |
11 |
cataggaaagggaacagctaggaagggaagaggataagactaacaaactnnnnnnntggttagaacataactaaaatccgtc |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35473325 |
cataggaaagggaacagctaggaagggaagaggatcagactaacaaactaaaaaaatggttagaacataactaaaatccgtc |
35473244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University