View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_low_46 (Length: 250)
Name: NF13133_low_46
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_low_46 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 26745984 - 26746229
Alignment:
| Q |
12 |
atgaaaattgtaaagaagattggtgattgaatgattcgaatcatgatatgttattgctggattgttttgttattcactgtcatcatatatatat--acac |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26745984 |
atgaaaattgtaaagaagattggtgaatgaatcattagaatcatgatatgttattgctggattgttttgttattcactgtcatcatatatatatacacac |
26746083 |
T |
 |
| Q |
110 |
atggtatggtaatcaaaaaggcatgtgaacaaaaacaggggtaacttcct-----tnnnnnnnnnncatgggtaactttttggtcttcgttccttctccc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
26746084 |
atggtatggtaatcaaaaaggcatgtgaacaaaaacaggggtaacttccttaaaataaaataaaaacatgggtaactttttggtcttcgttccttctccc |
26746183 |
T |
 |
| Q |
205 |
acggcatgatcataattcttcattttacccaattaagtcacccaac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26746184 |
acggcatgatcataattcttcattttacccaattaagtcacccaac |
26746229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University