View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13134_high_14 (Length: 217)
Name: NF13134_high_14
Description: NF13134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13134_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 3266467 - 3266327
Alignment:
| Q |
16 |
cttttctcttcattctgatggttgaggggaagtgtggagtaaactcgctaacgaggttaataccatggtagagttttcacttggccaccacttaaggtga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3266467 |
cttttctcttcattctgatggttgaggggcagtggggagtaaagtggctaacgaggttaataccttggtagagttttcacttggccaccacttaaggtga |
3266368 |
T |
|
| Q |
116 |
tatctttcttctggaagctcctccaggataagattcctact |
156 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3266367 |
tatctttcttctggaagctcctccatgataagattcctact |
3266327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 205
Target Start/End: Complemental strand, 3266317 - 3266285
Alignment:
| Q |
173 |
aacgtaggttgtttgtggatcatgttggtatct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3266317 |
aacgtaggttgtttgtggatcatgttggtatct |
3266285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University