View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13134_high_8 (Length: 301)
Name: NF13134_high_8
Description: NF13134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13134_high_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 22794909 - 22795216
Alignment:
| Q |
1 |
ccgagagtactttgccttcatttcgacgcaaatcacattctggag---gaggagatactcattttaattcaatgcatcccatcactgagacccctgaaaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22794909 |
ccgagagtactttgccttcatttcgacgcaaatcacattctggaggaggaggagatactcattttaattcaatgcatcccatcactgagacccctgaaaa |
22795008 |
T |
|
| Q |
98 |
taaaatcaactcgcgtcgccgttctttcatggggtatgtatgcatttttacttccaactactcgtctttttagtttgaaaaa--atatgtgttttctttt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
22795009 |
taaaatcaactcgcgtcgccgttctttcatggggtatgtatgcatttttacttacaactactcatctttttagtttgaaaaaatatatgtgttttctttt |
22795108 |
T |
|
| Q |
196 |
tgctcgtattcaatgtcatgagcaatttgta--tacatgcttctgcaggttcataaggaaaagtttgtcaaacaatgaaagcttcaatgatgaacagctt |
293 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22795109 |
tgctcgtattcaatgtcatgagcattttgtatgtgttttcttctgcaggttcataaggaaaagtttgtcaaacaatgaaagcttcaatgatgaacagctt |
22795208 |
T |
|
| Q |
294 |
gctgatga |
301 |
Q |
| |
|
|||||||| |
|
|
| T |
22795209 |
gctgatga |
22795216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University