View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13134_high_9 (Length: 280)
Name: NF13134_high_9
Description: NF13134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13134_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 28592082 - 28591835
Alignment:
| Q |
1 |
atagacacaattattaacgattttagtcgtagaattgttatgtatgaagatctcaattgcatgaatttcatatgcaattgaaaacatgggtgatttaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28592082 |
atagacacaattattaacgattttagtcgtagaattgttatgtatgagcatctcaattgcatgaatttcatatgcaattgaaaacatgggtaatttaatt |
28591983 |
T |
 |
| Q |
101 |
tatttttgtgtgtcgatccggatgaaacgctgaatcgatgcttcccatctggtttacttaataacgtactgtatattttgaatagtttcaagtttggaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28591982 |
tatttttgtgtgtcgatccggatgaaatgctgaat-----------tactggtt---ataagaacgtactgtatattttgaatagtttcaagtttggaag |
28591897 |
T |
 |
| Q |
201 |
attataaaattattttct-aactgggaaagtgaccaatgcttcaacaagcagatgtcctact |
261 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28591896 |
attataaaattattttctaaactgggaaagtgaccaatgcttcaataagcagatgtcctact |
28591835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University