View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13134_low_12 (Length: 249)
Name: NF13134_low_12
Description: NF13134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13134_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 91 - 239
Target Start/End: Complemental strand, 45193907 - 45193764
Alignment:
| Q |
91 |
gttagcacatgaccggccagtcaagaacagcttgccgccatttannnnnnnaatcattttgcaagagaaatcggaattttaaaaaatatttgcagctcat |
190 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45193907 |
gttagcacatgaccagccagccaagcacagcttgccgccatttatttttt-aatcattttgcaagagaaatgggaattttaaaaaatatttgcagctcat |
45193809 |
T |
|
| Q |
191 |
atctatctgttgatagtgcatagtacatacatccgtcgcatattaaaac |
239 |
Q |
| |
|
|||||||| || ||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
45193808 |
atctatctattaata----ataatacatacatccgtcacatattaaaac |
45193764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 10 - 77
Target Start/End: Complemental strand, 45194021 - 45193954
Alignment:
| Q |
10 |
gcatagggctgaatctgatacaagagatatgcttgctaccctggacctaaacaccataaatgcaaaaa |
77 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| ||| ||||| ||||||| |||||||||||||| |
|
|
| T |
45194021 |
gcataaggctgaatctgaaacaagagatatgcttactattctggatctaaacagcataaatgcaaaaa |
45193954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 241
Target Start/End: Complemental strand, 7161812 - 7161754
Alignment:
| Q |
176 |
atatttgcagctcatatctatctgttgatagtgcatagtacatacatccgtcgcatattaaaactc |
241 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
7161812 |
atatttgcagctcatatctatctgta-------catagtacatacatccgtcgtatattaaaactc |
7161754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 134
Target Start/End: Original strand, 27507588 - 27507638
Alignment:
| Q |
84 |
aagacaagttagcacatgaccggccagtcaagaacagcttgccgccattta |
134 |
Q |
| |
|
|||||||| |||||||||||| |||| |||| |||||||||||||||||| |
|
|
| T |
27507588 |
aagacaaggtagcacatgaccagccaaccaagcacagcttgccgccattta |
27507638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University