View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13134_low_15 (Length: 206)

Name: NF13134_low_15
Description: NF13134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13134_low_15
NF13134_low_15
[»] chr4 (1 HSPs)
chr4 (17-196)||(32264981-32265160)


Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 32265160 - 32264981
Alignment:
17 aattcaaaggttgaatataagtggttttcttttgaagctacaaatcaacgnnnnnnnnnnnnnggtccaacaaactttactaaaataccaagtaagtcat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||||    
32265160 aattcaaaggttgaatataagtggttttcttttgaagctacaaatcaacgttttttgttttttggtccaacaaactttactaaaataccaagtaagtcat 32265061  T
117 gtgtatcccttaacataaaattcagttctttggtcaattcatccccatgatgtgtgcggcacctaagacaaaaatctctg 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32265060 gtgtatcccttaacataaaattcagttctttggtcaattcatccccatgatgtgtgcggcacctaagacaaaaatctctg 32264981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University