View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13134_low_15 (Length: 206)
Name: NF13134_low_15
Description: NF13134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13134_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 32265160 - 32264981
Alignment:
| Q |
17 |
aattcaaaggttgaatataagtggttttcttttgaagctacaaatcaacgnnnnnnnnnnnnnggtccaacaaactttactaaaataccaagtaagtcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265160 |
aattcaaaggttgaatataagtggttttcttttgaagctacaaatcaacgttttttgttttttggtccaacaaactttactaaaataccaagtaagtcat |
32265061 |
T |
 |
| Q |
117 |
gtgtatcccttaacataaaattcagttctttggtcaattcatccccatgatgtgtgcggcacctaagacaaaaatctctg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265060 |
gtgtatcccttaacataaaattcagttctttggtcaattcatccccatgatgtgtgcggcacctaagacaaaaatctctg |
32264981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University