View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13135_low_1 (Length: 276)
Name: NF13135_low_1
Description: NF13135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13135_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 109 - 260
Target Start/End: Original strand, 6929820 - 6929972
Alignment:
| Q |
109 |
gggtggaaatttcttagttgtagggataacttcttttccaagttaccagtaactaaattaatgaatagagaaagatctccaaacaagctacacataaaaa |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6929820 |
gggtggaaattttttagttgtagggataacttcttttccaagttaccagtaactaaattaatgaatagagaaagatctccaaacaagctacacataaaaa |
6929919 |
T |
 |
| Q |
209 |
ttgaaggatatgctaat-cctcatagtatagaagttaaacaatgcttcaccaa |
260 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
6929920 |
ttgaaggatatgctaatccctcgtagtatagaagttaaacaatgcttcaccaa |
6929972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University