View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13136_low_13 (Length: 277)
Name: NF13136_low_13
Description: NF13136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13136_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 267
Target Start/End: Complemental strand, 4252904 - 4252633
Alignment:
| Q |
7 |
ctagttattagatatattatatagttaacaagaaatatgttggtgcagtggttgtgtaacgcatgtggactccgacaaagaagggaagaggcaaaagccg |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
4252904 |
ctagttattaaatatattatatagttaacaagaaatatgttggtgcagtggttgtgtaacgcatgtagactccgacgaagaagggaagaggcaaaagccg |
4252805 |
T |
|
| Q |
107 |
ataagggtcttgata-------ctcaaaaggaaaagggagatggcgaaagctcatcatctgaggatgtgaagaagtttcaatggtctcctggatttatct |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4252804 |
ataagggtcttgatagttgatactcaaaaggaaaagggaaatggtgaaagctcatcatctgaggatgtgaagaagttttaatggtctcctggatttatct |
4252705 |
T |
|
| Q |
200 |
tatggttttattcactcttaattagacgggca----atatggattctctttatagtgaggggttcatacatt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4252704 |
tatggttttattcactcttaattagacgggcaatatatatggattctctttatagtgaggggttcatacatt |
4252633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University