View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13136_low_14 (Length: 261)
Name: NF13136_low_14
Description: NF13136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13136_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 86 - 254
Target Start/End: Original strand, 43914794 - 43914962
Alignment:
| Q |
86 |
tatatctagacacagatactgaacgattttaaaacacatgtgaacgacatgctgcaaaaattagacacaaagcatgacaggaatctatttatttatgagc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43914794 |
tatatctagacacagatactgaacgattttaaaacacatgtgaacgacatgctgcaaaaattagacacaaagcatgacaggaatctatttatttatgagc |
43914893 |
T |
 |
| Q |
186 |
ttaatcaaacttattttttagcatgatatttccaaatcccggttaattaacaaatattaccctttgcta |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43914894 |
ttaatcaaacttattttttagcatgatatttccaaatcccggttaattaacaaatattaccctttgcta |
43914962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University