View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13136_low_15 (Length: 239)
Name: NF13136_low_15
Description: NF13136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13136_low_15 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 12 - 80
Target Start/End: Original strand, 337910 - 337978
Alignment:
| Q |
12 |
cgaagaatatacactaagaatcaagttttaatagttctgcaattatccacttttaacttagaaatgaat |
80 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
337910 |
cgaagaatgtacactaagaatcaagttttaatagttctgcaattatccacttttaacttagaaatgaat |
337978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University