View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13136_low_16 (Length: 236)
Name: NF13136_low_16
Description: NF13136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13136_low_16 |
 |  |
|
| [»] scaffold0076 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 113 - 218
Target Start/End: Original strand, 17088678 - 17088782
Alignment:
| Q |
113 |
cttagctgtcattgaaattttgtataactagacactgatgcaactctatcaacatctcatatgtagcctgcaaaacaataaaccattatctaacatgagg |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
17088678 |
cttagctgtcattgaaattt-gtataactagacactgatacaactctatcaacatctcatatgtagcctgcaaaacaataaacaattatctaacctgagg |
17088776 |
T |
 |
| Q |
213 |
cttgac |
218 |
Q |
| |
|
| |||| |
|
|
| T |
17088777 |
cgtgac |
17088782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 17088570 - 17088602
Alignment:
| Q |
5 |
ttgatgaaagtaatgttgtaaaaattagtcatg |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17088570 |
ttgatgaaagtaatgttgtaaaaattagtcatg |
17088602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 113 - 218
Target Start/End: Original strand, 6669 - 6772
Alignment:
| Q |
113 |
cttagctgtcattgaaattttgtataactagacactgatgcaactctatcaacatctcatatgtagcctgcaaaacaataaaccattatctaacatgagg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||| |||||||||||||| || |||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
6669 |
cttagctgtcattgaaattttgtataactaaccaccgatacaactctatcaacaact--tatgtaacctgcaaaacaataaaccattatctaaactgagg |
6766 |
T |
 |
| Q |
213 |
cttgac |
218 |
Q |
| |
|
| |||| |
|
|
| T |
6767 |
cgtgac |
6772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 113 - 169
Target Start/End: Complemental strand, 18595036 - 18594980
Alignment:
| Q |
113 |
cttagctgtcattgaaattttgtataactagacactgatgcaactctatcaacatct |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
18595036 |
cttagctgtcattgaaattttgtataactagacaccgatacaactctatcaacatct |
18594980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 39292250 - 39292210
Alignment:
| Q |
172 |
tatgtagcctgcaaaacaataaaccattatctaacatgagg |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
39292250 |
tatgtaacctgcaaaacaataaaccattatctaacctgagg |
39292210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University