View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13136_low_7 (Length: 448)
Name: NF13136_low_7
Description: NF13136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13136_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 6e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 265 - 444
Target Start/End: Original strand, 33890315 - 33890492
Alignment:
| Q |
265 |
actctttaatatttgtagcataaatttacatcttttaaatcacacagagttgtgcaaagcattccttacatacaattatagcatttgctctttttgtttt |
364 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33890315 |
actctttaatatttgtagcataaattcacatcttttaaatcaca--gagttatgcaaagcattccctacatacaattatagcatttgctctttttgtttt |
33890412 |
T |
|
| Q |
365 |
aaaaaggcaagaaaattgtaggagtttcatcacattatgctaattccctaaatagatagatgacatggttatagtattat |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33890413 |
aaaaaggcaagaaaattgtaggagtttcatcacattatgctaattccctaaatagataaatgacatggttatagtattat |
33890492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 87 - 198
Target Start/End: Original strand, 33890137 - 33890248
Alignment:
| Q |
87 |
tgagacattatttctagagatttgagaaagaatttgctgcaacaagttatgttcttcagaggtttttaaagactcatggtgagccaacttttcaacatca |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33890137 |
tgagacattatttctagagatttgagaaagaatttgctgcaacaagttatgttctttagaggtttttaaagactcatggtgagccaaattttcaacatca |
33890236 |
T |
|
| Q |
187 |
taactattaatg |
198 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33890237 |
taactattaatg |
33890248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University