View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13137_high_10 (Length: 249)
Name: NF13137_high_10
Description: NF13137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13137_high_10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 5 - 249
Target Start/End: Original strand, 48731364 - 48731608
Alignment:
| Q |
5 |
gtgaaatgaagataaggaaaaattgttgtatatccctt-gttatataaaagtcccacatcggtaactttgaaagaaaataggatggacactaagttatat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48731364 |
gtgaaatgaagataaggaaaaattgttgtatagccctttgttatataaaagtcccacatcggtaactttgaaagaaaataggatggacactaagttatat |
48731463 |
T |
|
| Q |
104 |
cacgaacagctcaacccgactcatttccaaccctagatgnnnnnnnntgaactatattcatcgacctgcttatcgggggnnnnnnntattctgacattaa |
203 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48731464 |
cacgaacagctcagcccgattcatttccaaccctagatg-aaaaaaatgaactatattcatcgacctgcttatcggggggaaaaaatattctgacattaa |
48731562 |
T |
|
| Q |
204 |
tattgtggaaatagtaaagaacgatctttggttacatacacgtact |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48731563 |
tattgtggaaatagtaaagaacgatctttggttacatacacgtact |
48731608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University