View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13137_low_7 (Length: 338)
Name: NF13137_low_7
Description: NF13137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13137_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 52 - 338
Target Start/End: Complemental strand, 48732238 - 48731952
Alignment:
| Q |
52 |
taagccaatttgagggatgaaatgcaaggttttccctgtttgcattcctcattatcagttttggtttatacaggggttcgcccattcaattatggttgtc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48732238 |
taagccaatttgagggatgaaatgcaaggttttccctgtttgcattcctcattatcagttttggttcatacaggggttcgcccattcaattatggttgtc |
48732139 |
T |
 |
| Q |
152 |
tgaacagttcaccagtcaatcctgaaattgagttgcattcctccttcccctgatcaaagttctgactattttgtagtatatttatgtttgcattgatata |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48732138 |
tgaacagttcaccagtcaatcctgaaattgagttgcattcctccttcccctgatcaaagttctgactattttgtagtatatttatgtttgcattgatata |
48732039 |
T |
 |
| Q |
252 |
tgcctagcatagcagcaggttttaactaaatgaggactaatgatcaaattgctttacttgtcttgaatagcagcttaagaaatgtgt |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48732038 |
tgcctagcatagcagcaggttttaactaaatgaggactaatgattaaattgctttacttgtcttgaatagcagcttaagaaatgtgt |
48731952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University