View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13137_low_8 (Length: 319)
Name: NF13137_low_8
Description: NF13137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13137_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 303
Target Start/End: Original strand, 42236803 - 42237082
Alignment:
| Q |
19 |
ggtgataacaaagacaattctgtggaagttcaacatgttaacaaaggtgatcaaggtcatggttccgctgtagagagaaagcctcgtagaggttccatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236803 |
ggtgataacaaagacaattctgtggaagttcaacatgttaacaaaggtgatcaaggtcatggttccgctgtagagagaaagcctcgtagaggttccatgg |
42236902 |
T |
|
| Q |
119 |
acatgatttcaccatttggtgagttttcatctcttttttcatcaacaccaagaatactagcaacacattttctcataccaaatttaaaatttatgattcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236903 |
acatgatttcaccatttggtgagttttcatctcttttttcatcaacaccaagaatactagcaacacattttctcataccaaatttaaaatttatgattct |
42237002 |
T |
|
| Q |
219 |
tattagatcatgtgcgcgcgtctcatgtcatatatgtttgatgaaaaataaatctttaatgtgtgattctagtatttttcatttc |
303 |
Q |
| |
|
| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42237003 |
tgttagatcaggtgcgcgcgtc-----tcatatatgtttgatgaaaaataaatctttaatgtgtgattcttgtatttttcatttc |
42237082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University