View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13138_high_39 (Length: 237)
Name: NF13138_high_39
Description: NF13138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13138_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42982544 - 42982764
Alignment:
| Q |
1 |
ctgcatttcttgaatactattacgtgaatctacgtagtgtcgtcatcggaggaaaacgtgttaagattccagaaattggaaccgacggtaatggtggtac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42982544 |
ctgcatttcttgaatactattacgtgaatctacgtagtgtcgtcatcggaggaaaacgtgttaagattccagaaattggaaccgacggtaatggtggcac |
42982643 |
T |
 |
| Q |
101 |
tatcgttgattctggatcaacgttcactttcatggaacgtaaaatctacgatttggtggcaaaggagtttgaaaaacagctttcgaatttcacaagagcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42982644 |
tatcgttgattctggatcaacgttcactttcatggaacgtaaaatctacgatttggtggcaaaggagtttgaaaaacagctttcgaatttcacaagagcg |
42982743 |
T |
 |
| Q |
201 |
aaagatattgaaggtgaatca |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42982744 |
aaagatattgaaggtgaatca |
42982764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University