View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13138_low_36 (Length: 241)
Name: NF13138_low_36
Description: NF13138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13138_low_36 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 27 - 241
Target Start/End: Original strand, 39983798 - 39984014
Alignment:
| Q |
27 |
aataaataatttatcaggcttagtctattttctttttgaagggatttgtgtaatctatatgcacctttaaatctacatatgcaccatttaattttcaatt |
126 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39983798 |
aataaataataaataaggcttagtctattttctttttgaagggatttgtgtaatctatatgcacctttaaatctacatatgcaccatttaatttttaatt |
39983897 |
T |
 |
| Q |
127 |
gtttattgttacatcgatgacccgttgaa--gnnnnnnnnncaagtaatcttgttgaagttatagtaaatatgtatttcactagccattattagcactat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
39983898 |
gtttattgttacatcgatgacccgttgaaatttttttttgtcaagtactctcgttgaagttatagtaaatatgtatttcattagccattattaacactat |
39983997 |
T |
 |
| Q |
225 |
taatttacactataaac |
241 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39983998 |
taatttacactataaac |
39984014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University