View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13138_low_38 (Length: 240)
Name: NF13138_low_38
Description: NF13138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13138_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 3319109 - 3319331
Alignment:
| Q |
1 |
cttaaacaaagtttccattcaactgctaacaaatggaaacggaaaatggaaaatagagnnnnnnnncatgttattatttagaaaattttcacgaggatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
3319109 |
cttaaacaaagtttccattcaactgctaacaaatggaaacggaaaatggaaaatagagaaaaaaaacatgttatgatttagaaaattttcacgaggatac |
3319208 |
T |
|
| Q |
101 |
gaatcttgaggtcgtgtcgcgcctcctcttatctatcaacctccttttgatggggctcatatgatgcctcaagcttaggctttagcgtcctttgttgtac |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3319209 |
aaatcttgaggccgtgtcgcgcctcctcttatatatcaacctccttctgatggggctcatgtgatgcctcaagcttaggctttggcgtcctttgttgtac |
3319308 |
T |
|
| Q |
201 |
gctctttcttagacgagactttc |
223 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
3319309 |
gctctttcctagacgagactttc |
3319331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 52
Target Start/End: Complemental strand, 311360 - 311314
Alignment:
| Q |
6 |
acaaagtttccattcaactgctaacaaatggaaacggaaaatggaaa |
52 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
311360 |
acaaaatttccattcaactactaacaaatggaaacagaaaagggaaa |
311314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University