View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13139_high_18 (Length: 485)
Name: NF13139_high_18
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13139_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 6e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 126 - 267
Target Start/End: Original strand, 7732578 - 7732716
Alignment:
| Q |
126 |
taagaaaccagattaaaaaatt-tctacaaagatgaatcaccaagttctatccagcacatgaactttcttttgttggtgggttactactacatacttcta |
224 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| ||||||||| || ||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
7732578 |
taagataccagattaaaaaaaaatcttcaaagatgaatcactaagttctattcaacacatgaactttcttttgt-ggtgggttact---acatacttcta |
7732673 |
T |
|
| Q |
225 |
atgtctgtatttctttgcacaaattcattatacaagaacatct |
267 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7732674 |
atgtctgtatttctttgcacaaaatcattatacaagaacatct |
7732716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University