View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13139_high_31 (Length: 335)
Name: NF13139_high_31
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13139_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 130 - 331
Target Start/End: Complemental strand, 1703864 - 1703663
Alignment:
| Q |
130 |
cagataatgatgcactgtacattacttttattgatttcctagacatatttataaagagggaaaaaagataaacacctttgacctgaaaatagatttcacc |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1703864 |
cagataatgatgcactgtacattacttatattgatttcctagacatatttataaagagggaaaaaagataaacacctttgacctgaaaatagatttcacc |
1703765 |
T |
 |
| Q |
230 |
ataacaggataaataataaatttattatatttacgaaattaataacattaaataaggtctctgcttcaaagtttgtgcattctggtccttttcttttctc |
329 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1703764 |
ataaaaggataaataataaatttattatatttacgaaattaataacattaaataaggtctctgcttcaaagtttgtgcattctggtccttttcttttatc |
1703665 |
T |
 |
| Q |
330 |
tc |
331 |
Q |
| |
|
|| |
|
|
| T |
1703664 |
tc |
1703663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 48
Target Start/End: Original strand, 15439900 - 15439928
Alignment:
| Q |
20 |
gtaatctatcaatttaaatgaataaatat |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15439900 |
gtaatctatcaatttaaatgaataaatat |
15439928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University