View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13139_high_39 (Length: 250)
Name: NF13139_high_39
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13139_high_39 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 6 - 250
Target Start/End: Original strand, 33519366 - 33519610
Alignment:
| Q |
6 |
agtgatatgaattaaaagaaaatggctatatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgag |
105 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519366 |
agtgacatgaattaaaagaaaatggctctatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgag |
33519465 |
T |
 |
| Q |
106 |
taccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519466 |
taccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatca |
33519565 |
T |
 |
| Q |
206 |
ataactacggggctctctatgccaaggaatgctacctctcaactt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
33519566 |
ataactacggggctctctatgccaaggattgctacctctctactt |
33519610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 75 - 250
Target Start/End: Complemental strand, 33496521 - 33496346
Alignment:
| Q |
75 |
aaggttactagatcccctagtttttggcgagtaccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctc |
174 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| || |||||| | | |||| | ||||||||||| ||| |
|
|
| T |
33496521 |
aaggttactagatcccctagtttttggtgagtaccctgctgagatgcgctctattcttgggaaccggttgccaaagatctctacgaaggagaagagtctc |
33496422 |
T |
 |
| Q |
175 |
ctaagaggcagcctggacttcattggcatcaataactacggggctctctatgccaaggaatgctacctctcaactt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| |||| |
|
|
| T |
33496421 |
ctaagaggcagcctggacttcattggcatcaataactatggagctctctatgccaaggattgctacctctctactt |
33496346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University