View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13139_high_45 (Length: 205)

Name: NF13139_high_45
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13139_high_45
NF13139_high_45
[»] chr7 (1 HSPs)
chr7 (16-205)||(2432178-2432367)


Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 2432367 - 2432178
Alignment:
16 atgatgaatgtgtactggaggtgtcgtagagcgtctacgaataaatgaatgtattagctatcttgatacaagcttaatgctcataaaaattatgggggta 115  Q
    ||||| |||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||| ||||    
2432367 atgataaatgtgtactagatgtgtcgtagagcgtctacgaataaaggaatgtattagctatcttgatagaagcttaatgctcatgaaaattatggtggta 2432268  T
116 ttggtgttaaagacctcacgacctttaatttggtgaggcttagttatagtcaacggtggaaattcccagcacagattgattcattggtat 205  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||| ||||    
2432267 ttggttttaaagacctcacgacctttaatttggtgaggcttagttatattcaacggtggaaattccaaacacagattgattcatttgtat 2432178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University