View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13139_low_23 (Length: 459)
Name: NF13139_low_23
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13139_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 8e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 14 - 141
Target Start/End: Complemental strand, 2442974 - 2442847
Alignment:
| Q |
14 |
tactgtaatttgtggcaatgaacgtttgatagaaaatgtagcaggggttatgaagaacatttagacgatgtagggagcagcttcagtcaaataaattagg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2442974 |
tactgtaatttgtggcaatgaacgtttgatagaaaatgtagcaggggttatgaagaacagtttgacgatgtagggagtagcttcagtcaaataaattagg |
2442875 |
T |
|
| Q |
114 |
ttttctatgtcataaatcttctataata |
141 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2442874 |
ttttctatgtcataaatcttctataata |
2442847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 349 - 424
Target Start/End: Complemental strand, 2435445 - 2435370
Alignment:
| Q |
349 |
ataatcaaatcagtggttgaggcaatccactcatatgtcatgaacatatttctcattcccactactattatcgatg |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
2435445 |
ataatcaaatcagtggttgaggcaatccactcatatgtcaagaacatatttctcattcccactactattattgatg |
2435370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University