View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13139_low_31 (Length: 360)
Name: NF13139_low_31
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13139_low_31 |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 5 - 342
Target Start/End: Complemental strand, 28940008 - 28939677
Alignment:
| Q |
5 |
gaggttttagaaaagatggtgagatcttgctggaagccagctgtagctggtgatgatggagatgtgagtggaagtggaagtggaagtggtgggagagttg |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||| || |||||||| |
|
|
| T |
28940008 |
gaggtttgagaaaagatggtgagatcttgctggaagccagctgtagatggtgatgatggggatgggagtggaagtggaagtgg------tgagagagttg |
28939915 |
T |
 |
| Q |
105 |
atggattgttatggtacaaagatttagggaaccatatttatggtgaattttcaatggctgtgattcaagctaatagttcattggaggatagaagtgaatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28939914 |
atggattgttatggtacaaagatttagggaaccatatttatggtgaattttcaatggctgtgattcaagctaatagttcattggaggatagaagtgaatt |
28939815 |
T |
 |
| Q |
205 |
tgagtctggacctttgagttctaaccatttgggtcctcaagggacttttattggtgtttatgatggtcatggtggagctgaagcttctcaatttgtcagc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28939814 |
tgagtctggacctttgagttctaaccatttgggtcctcaagggacttttattggtgtttatgatggtcatggtggagctgaagcttctcaatttgtcagt |
28939715 |
T |
 |
| Q |
305 |
gacaatcttttttgcaatctcaaaagtattttcattct |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28939714 |
gacaatcttttttgcaatctcaaaagtattttcattct |
28939677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 95 - 333
Target Start/End: Complemental strand, 40327511 - 40327273
Alignment:
| Q |
95 |
gggagagttgatggattgttatggtacaaagatttagggaaccatatttatggtgaattttcaatggctgtgattcaagctaatagttcattggaggata |
194 |
Q |
| |
|
|||| ||||||||||||| | ||||| || ||||| || |||||| ||||||||||||||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
40327511 |
gggaaagttgatggattgctgtggtataaggatttgggaaaccatctttatggtgaattttcaatggctgtaattcaagcaaatagttcgttggaggatc |
40327412 |
T |
 |
| Q |
195 |
gaagtgaatttgagtctggacctttgagttctaaccatttgggtcctcaagggacttttattggtgtttatgatggtcatggtggagctgaagcttctca |
294 |
Q |
| |
|
| || || |||| || |||||| |||||||| | |||||||||||||||| || ||||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
40327411 |
gtagccaacttgaatcaggacctatgagttctgattatttgggtcctcaaggaacctttataggtgtttatgatggtcatggtggaactgcagcttctca |
40327312 |
T |
 |
| Q |
295 |
atttgtcagcgacaatcttttttgcaatctcaaaagtat |
333 |
Q |
| |
|
||||| | |||||||| || | |||| |||| ||||| |
|
|
| T |
40327311 |
gtttgttaatgacaatctattctccaatttcaagagtat |
40327273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 250 - 292
Target Start/End: Complemental strand, 73558 - 73516
Alignment:
| Q |
250 |
ttttattggtgtttatgatggtcatggtggagctgaagcttct |
292 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
73558 |
ttttgttggtgtttatgatggtcatggtggtcctgaagcttct |
73516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University