View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13139_low_42 (Length: 248)
Name: NF13139_low_42
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13139_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 35 - 166
Target Start/End: Original strand, 28342679 - 28342810
Alignment:
| Q |
35 |
tgaagagcgaggaaaacgcagagggttgtaggataactcattctataatgtgtattctcttgtgaaccaaaatacataattgcaatctctcacggttcaa |
134 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||| |||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28342679 |
tgaagagcgaagaaaacgcagagggttgtaggataactccttctatagtgtgtattatcttatgaaccaaaatacataattgcaatctctcacggatcaa |
28342778 |
T |
|
| Q |
135 |
cacaacagtgtaatctcttacagaccaacacc |
166 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
28342779 |
cacaacagtgtaatctcttaccgaccaacacc |
28342810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 143 - 248
Target Start/End: Original strand, 28342815 - 28342930
Alignment:
| Q |
143 |
tgtaatctcttacagaccaacacctttactataaaattga----------atactccatttacactaatgcaacaatttacatattaatccagcatatat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28342815 |
tgtaatctcttacagaccaacacctttactataaaattgataagtgtattatactccatttacgctaatgcaacaatttacatattaatccagcatatat |
28342914 |
T |
|
| Q |
233 |
aataaaaatcataatc |
248 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28342915 |
aataaaaatcataatc |
28342930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University