View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13139_low_45 (Length: 230)
Name: NF13139_low_45
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13139_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 28 - 186
Target Start/End: Original strand, 41087382 - 41087541
Alignment:
| Q |
28 |
tattgttgcattggatggtgcttactattgcattggaggctattacaaataaatttgtgtttttgcttgatgaactcttattttgtttgtgga--nnnnn |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41087382 |
tattgttgcattggatggtgcttactattgcattgcaggctattacaaataaatttgtg-gtttgcttgatgaactcttattttgtttgtggattttttt |
41087480 |
T |
|
| Q |
126 |
nnnnaattaattgttagattagttttttctcgtttactcgagtttgaactcaatacttcaa |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41087481 |
ttttaattaattgttagattagttttttctcgtttacccgagtttgaactcaatacttcaa |
41087541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 72 - 181
Target Start/End: Original strand, 41089777 - 41089882
Alignment:
| Q |
72 |
acaaataaatttgtgtttttgcttgatgaactcttattttgtttgtggannnnnnnnnaattaattgttagattagttttttctcgtttactcgagtttg |
171 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| || ||| | ||||| |
|
|
| T |
41089777 |
acaaataaatttgcgtttttgcttgatgaactcttattttgtttgtg----tttttttaattaattgttagattatttttttctccttcacttgggtttg |
41089872 |
T |
|
| Q |
172 |
aactcaatac |
181 |
Q |
| |
|
||||| |||| |
|
|
| T |
41089873 |
aactcgatac |
41089882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 70 - 120
Target Start/End: Original strand, 41076375 - 41076425
Alignment:
| Q |
70 |
ttacaaataaatttgtgtttttgcttgatgaactcttattttgtttgtgga |
120 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
41076375 |
ttacaaataattttgtattttttcttgatgaactcttattttgtttgtgga |
41076425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University