View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13139_low_47 (Length: 205)
Name: NF13139_low_47
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13139_low_47 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 2432367 - 2432178
Alignment:
| Q |
16 |
atgatgaatgtgtactggaggtgtcgtagagcgtctacgaataaatgaatgtattagctatcttgatacaagcttaatgctcataaaaattatgggggta |
115 |
Q |
| |
|
||||| |||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||| |||| |
|
|
| T |
2432367 |
atgataaatgtgtactagatgtgtcgtagagcgtctacgaataaaggaatgtattagctatcttgatagaagcttaatgctcatgaaaattatggtggta |
2432268 |
T |
 |
| Q |
116 |
ttggtgttaaagacctcacgacctttaatttggtgaggcttagttatagtcaacggtggaaattcccagcacagattgattcattggtat |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
2432267 |
ttggttttaaagacctcacgacctttaatttggtgaggcttagttatattcaacggtggaaattccaaacacagattgattcatttgtat |
2432178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University