View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13139_low_48 (Length: 204)
Name: NF13139_low_48
Description: NF13139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13139_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 546937 - 546760
Alignment:
| Q |
20 |
ggttgctggttataagaatcctgattgttttcaccttcaatggaaatacattattgcagaagattctttgcagaccatgctaaacttgtagattca---- |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
546937 |
ggttgctggttataagaatcctgattgttttcaccttcaagggaaatacattattgcagaagattctttgcagaccatgctaaacttgtagattcaaatt |
546838 |
T |
 |
| Q |
116 |
---aataaaatttatgtgtgtaatgctcaatacctgggatggacaaaatatatttggttgtacatatatttgcctttg |
190 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
546837 |
ttgaataaaattaatgtgtgtaatgctcaatacctgggatggacaaaatatatttggttgtacatatatttgcctttg |
546760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University