View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1313_high_19 (Length: 225)
Name: NF1313_high_19
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1313_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 35409924 - 35409716
Alignment:
| Q |
1 |
tacaaagaattcatcaacatggggaagcgtgatcataaaaatgctatctggtggcataaatgtaacccctctgaggatctcatctccttgcttaccacca |
100 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||||||||||||||| |||||||| |||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
35409924 |
tacaaagaattcatcaacatggggcaccctgatcataaaaatgctacctggtggcctaaactaaacacccctgaggatctcatctccttgcttaccacca |
35409825 |
T |
 |
| Q |
101 |
ttatctggactgtatcagcgcaacatgctgtcttgaacttcagtcaatacccctatggtggatatgttccaatccggccacaattaatgcgaaaattaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409824 |
ttatctggactgtatcagcgcaacatgctgtcttgaacttcagtcaatacccctatggtggatatgttccaatccggccacaattaatgcgaaaattaat |
35409725 |
T |
 |
| Q |
201 |
tcctaatga |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
35409724 |
tcctaatga |
35409716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University