View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1313_high_21 (Length: 201)
Name: NF1313_high_21
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1313_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 48907389 - 48907224
Alignment:
| Q |
1 |
aggttggatgtgttaatgataagaaagagagagcatacattttaagatgtgctattaatttggtgatcaaattgctttgatgtcannnnnnnnnnnggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
48907389 |
aggttggatgtgttaatgataagaaagagag--catacattttaagatgtgctattaatttggcgatcaaattgctttgatgtcatttttttg---ggta |
48907295 |
T |
 |
| Q |
101 |
catcctttgataatatgtattaattgatgaaattgctgttatccttttcctgtttattagaaatacatatt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48907294 |
catcctttgataatatgtattaattgatgaaattgctgttatccttttcctgtttattagaaatacatatt |
48907224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University