View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1313_low_21 (Length: 316)
Name: NF1313_low_21
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1313_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 11 - 287
Target Start/End: Original strand, 42053891 - 42054167
Alignment:
| Q |
11 |
cagagagctgtcgtagtgagagaaagcagcacggttagggtttctaacggaggcgtattgagagaaggtgaagttgacggtgccgttaatgacggagaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42053891 |
cagagagctgtcgtagtgagagaaagcagcacggttagggtttctaacggaggcgtattgagagaaggtgaagttgacggtgccgttaatgacggagaag |
42053990 |
T |
|
| Q |
111 |
gaggggagttggacggcgttgacggcgatcttggggtcttgtggtttgaaaacagtgtagtatactatgaggatgacgatgatgatgaaaatcaagaaga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42053991 |
gaggggagttggacggcgttgacggcgatcttggggtcttgtggtttgaaaactgtgtagtatactatgaggatgacgatgatgatgaaaatcaagaaga |
42054090 |
T |
|
| Q |
211 |
ttgtggctactacacatgaggctaggttggtacggccggaaggtggtcgtggtctttttggtctggtggtggggatg |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42054091 |
ttgtggctactacacatgaggctaggttggtacggccggaaggtggtcgtggtctttttggtctggtggtggggatg |
42054167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 2113551 - 2113503
Alignment:
| Q |
44 |
gttagggtttctaacggaggcgtattgagagaaggtgaagttgacggtg |
92 |
Q |
| |
|
|||||||||| |||| || | |||||||||||||||||||||||||||| |
|
|
| T |
2113551 |
gttagggtttttaacagaagtgtattgagagaaggtgaagttgacggtg |
2113503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University