View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1313_low_32 (Length: 261)
Name: NF1313_low_32
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1313_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 47012235 - 47012452
Alignment:
| Q |
1 |
tataaaacgatattttctaaaatataaaagtcgagttatttatttgataaaaatgatggtgaatttattgatttattgaagcaaatatattattcgtaca |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
47012235 |
tataaaacgatattttttaaaatataaaaatcgagttatttatttgataaaaatgatggtgaatttattgattttttgaagcaaatatattgttcgtaca |
47012334 |
T |
|
| Q |
101 |
tcaattgctttccactaaatttccttttatggtaggacaaaattgtcctcgttcaaggacttgcttgttcagtgtctttactttgtacatattttgtctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
47012335 |
tcaattgctttccactaaatttccttttatggtaggacaaaattgtcctcgttcaaggacttgcttgttcactgtctttactttttacgtattttgtctc |
47012434 |
T |
|
| Q |
201 |
ttcctaaacgcttttctt |
218 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
47012435 |
ttccaaaacgcttttctt |
47012452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University