View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1313_low_34 (Length: 258)
Name: NF1313_low_34
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1313_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 236
Target Start/End: Complemental strand, 21112914 - 21112685
Alignment:
| Q |
7 |
aattaatcgatgttgacttttgtagaaagaggttaagtctgttgctctcaaatttttgatttcctcgatatgagtaattattggatttgtgtatgtcaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21112914 |
aattaatcgatgttgacttttgtagaaagaggttaagtctcttgctctcaaatttttgatttcctcgatatgagtaattattggatttgtgtatgtcaat |
21112815 |
T |
|
| Q |
107 |
taggaaaacatatcggaggagatttttgtgttcagaactaaatattctaagaatgattttgcaaggtgtgcaaataacatgtaccctttgttttgtattt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21112814 |
taggaaaacatatcggaggagatttttgtattcagaactaaatattctaagaatgactttgcaaggtgtgcaaataacatgtaccctttgttttgtattt |
21112715 |
T |
|
| Q |
207 |
aaaattaaaatatatggagaatgttgatga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21112714 |
aaaattaaaatatatggagaatgttgatga |
21112685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University