View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1313_low_38 (Length: 251)
Name: NF1313_low_38
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1313_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 33220610 - 33220850
Alignment:
| Q |
1 |
tatacccttgaaattgttttaccataataaaaacatgaaattggtcagtgatgattatcctgaaacaaatgaaaaagaaaagattaggcttgcattggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33220610 |
tatacccttgaaattgttttaccataataaaaacatgaaattggtcagtgatgattatcctgaaacaaatgaaaaagaaaagattaggcttgcattggta |
33220709 |
T |
|
| Q |
101 |
agatatagctggcagtgaaataaatataatttggatatatttgctattgtaataaatgcatcatatttggaaaatcaaactaatatgataaggcctaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33220710 |
agatatagctggcagtgaaataaatataatttggatatatttgctattgtaataaatgcatcatatttggaaaatcaaactaatatgataaggcctaagg |
33220809 |
T |
|
| Q |
201 |
tgtttgcagctattgatcgaatctaatcatatgtgtctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33220810 |
tgtttgcagctattgatcgaatctaatcacatgtgtctgtg |
33220850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University