View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1313_low_42 (Length: 225)

Name: NF1313_low_42
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1313_low_42
NF1313_low_42
[»] chr4 (1 HSPs)
chr4 (1-209)||(35409716-35409924)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 35409924 - 35409716
Alignment:
1 tacaaagaattcatcaacatggggaagcgtgatcataaaaatgctatctggtggcataaatgtaacccctctgaggatctcatctccttgcttaccacca 100  Q
    |||||||||||||||||||||||| | | ||||||||||||||||| |||||||| ||||   ||| || ||||||||||||||||||||||||||||||    
35409924 tacaaagaattcatcaacatggggcaccctgatcataaaaatgctacctggtggcctaaactaaacacccctgaggatctcatctccttgcttaccacca 35409825  T
101 ttatctggactgtatcagcgcaacatgctgtcttgaacttcagtcaatacccctatggtggatatgttccaatccggccacaattaatgcgaaaattaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35409824 ttatctggactgtatcagcgcaacatgctgtcttgaacttcagtcaatacccctatggtggatatgttccaatccggccacaattaatgcgaaaattaat 35409725  T
201 tcctaatga 209  Q
    |||||||||    
35409724 tcctaatga 35409716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University