View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1313_low_8 (Length: 410)
Name: NF1313_low_8
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1313_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 35410012 - 35409716
Alignment:
| Q |
1 |
tagtatagagaagttggtcaggacctatgtgaaccattactacaaagatttgaatgccgtttcttctgacaatgaactccagtcctggtacaaagaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35410012 |
tagtatagagaagttggtcaggacctatgtgaaccattactacaaagatttgaatgccatttcttctgacaatgaactccagtcctggtacaaagaattc |
35409913 |
T |
 |
| Q |
101 |
atcaacatggggcaccctgatcataaaaatgctacctggtggcctaaactaaacacccctgaggatctcatctccttgcttaccaccattatctggactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409912 |
atcaacatggggcaccctgatcataaaaatgctacctggtggcctaaactaaacacccctgaggatctcatctccttgcttaccaccattatctggactg |
35409813 |
T |
 |
| Q |
201 |
tatcagcgcaacatgctgtcttgaacttcagtcaatacccctatggtggatatgttccaatccggccacaattaatgcgaaaattaattcctaatga |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409812 |
tatcagcgcaacatgctgtcttgaacttcagtcaatacccctatggtggatatgttccaatccggccacaattaatgcgaaaattaattcctaatga |
35409716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University