View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13140_high_18 (Length: 354)
Name: NF13140_high_18
Description: NF13140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13140_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 297; Significance: 1e-167; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 21 - 345
Target Start/End: Complemental strand, 22278444 - 22278120
Alignment:
| Q |
21 |
tacttcttcaaagcctcttcaggtatcatttccgctatcaattctattttatgttgtcttttttggggtgggggtgaggaatataggtaaactttctggg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
22278444 |
tacttcttcaaagcctcttcaggtatcatttcctctatcgattctattttatgttgtcttttttggggtgggggtgaggaatataggtaaattttctagg |
22278345 |
T |
 |
| Q |
121 |
tttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22278344 |
tttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtg |
22278245 |
T |
 |
| Q |
221 |
gatcagggtgattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggagtctgggagggtcgagttggtggaaaga |
320 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
22278244 |
gatcagggggattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggggtctgggagggtcgagttggtggaagga |
22278145 |
T |
 |
| Q |
321 |
tatcgtgaggattcgtgatgatgtc |
345 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
22278144 |
tatcgtgaggattcgtgatgatgtc |
22278120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 147 - 223
Target Start/End: Complemental strand, 7287375 - 7287299
Alignment:
| Q |
147 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
223 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7287375 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 147 - 223
Target Start/End: Complemental strand, 7288043 - 7287967
Alignment:
| Q |
147 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
223 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7288043 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 92
Target Start/End: Original strand, 41352565 - 41352634
Alignment:
| Q |
23 |
cttcttcaaagcctcttcaggtatcatttccgctatcaattctattttatgttgtcttttttggggtggg |
92 |
Q |
| |
|
||||||||||||| | |||| |||||||||| |||| |||||||||||||| || | |||| ||||||| |
|
|
| T |
41352565 |
cttcttcaaagccccgtcagatatcatttcctctattgattctattttatgtcgtttcttttagggtggg |
41352634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 220
Target Start/End: Original strand, 51072127 - 51072196
Alignment:
| Q |
151 |
aggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtg |
220 |
Q |
| |
|
||||||||||| ||||||| ||| || | || |||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
51072127 |
aggaaggaggtttgggggtcaggaggatgagggagtttaatgttgctctgttagggaaatggtgttggtg |
51072196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University