View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13140_high_22 (Length: 277)
Name: NF13140_high_22
Description: NF13140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13140_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 170 - 270
Target Start/End: Complemental strand, 25043671 - 25043571
Alignment:
| Q |
170 |
tgtacccacggcaacaacactttgtagtttctgttaagatacaacaaaatttattcttagtttcctggacatattttatttccaaggcatttgctttggt |
269 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25043671 |
tgtacccacggcaacaacactttggagtttctgttaagatacaacaaaatttattcttagtttcctggacagattttatttccaaggcatttgctttggt |
25043572 |
T |
 |
| Q |
270 |
t |
270 |
Q |
| |
|
| |
|
|
| T |
25043571 |
t |
25043571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 5 - 109
Target Start/End: Complemental strand, 25043839 - 25043732
Alignment:
| Q |
5 |
tgtgtagttagtct----atattttgtgtttgctttcaggaataatgatgtttgattccatttcttttttcataaactacaaaacaattattggttattg |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25043839 |
tgtgtagttagtctatatatattttgtgtttgcttt-aggaataatgatgtttgtttccatttcttttttcataaactacaaaacaattattggttattg |
25043741 |
T |
 |
| Q |
101 |
tatatgcat |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
25043740 |
tatatgcat |
25043732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University