View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13140_high_24 (Length: 237)

Name: NF13140_high_24
Description: NF13140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13140_high_24
NF13140_high_24
[»] chr2 (3 HSPs)
chr2 (106-167)||(4391585-4391646)
chr2 (176-223)||(4391972-4392019)
chr2 (1-39)||(4391473-4391511)


Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 106 - 167
Target Start/End: Original strand, 4391585 - 4391646
Alignment:
106 gtactcttaatcttcctaaaatgatgctttttgtggaaaaactatatacatgaattaattcc 167  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||    
4391585 gtactcttaatcttcctaaaatgatgctttttctggaaaaactatagacatgaattaattcc 4391646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 4391972 - 4392019
Alignment:
176 gggtagaatatacatgaattttaatttacattaagtgatggaaaatat 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
4391972 gggtagaatatacatgaattttaatttacattaagtgatggaaaatat 4392019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 4391473 - 4391511
Alignment:
1 attcattatattagatgatattgcaaatgaactagatgc 39  Q
    |||||||||||||||||||||||||||||||||||||||    
4391473 attcattatattagatgatattgcaaatgaactagatgc 4391511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University