View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13140_low_13 (Length: 420)
Name: NF13140_low_13
Description: NF13140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13140_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 6e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 29 - 203
Target Start/End: Complemental strand, 4241790 - 4241616
Alignment:
| Q |
29 |
gtatacctttggagccatccagtttgaattttccttgaaggagtgtgcactgctcagccacatatcccggaagctgtctaaattggaaattctaagttac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4241790 |
gtatacctttggagccatccagtttgaattttccttgaaggattgtgcactgctcagccacatatcccggaagctgtctaaattggaaattctaagtaac |
4241691 |
T |
 |
| Q |
129 |
tcaaattgaaaataaagggtaatactcattctagaattatcataaatcataatagtcacaataactaacgagtat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4241690 |
tcaaattgaaaataaagggtaatactcattctagtattatcataaatcataatagtcacaataactaacgagtat |
4241616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University