View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13140_low_19 (Length: 368)
Name: NF13140_low_19
Description: NF13140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13140_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 298
Target Start/End: Complemental strand, 54395330 - 54395056
Alignment:
| Q |
18 |
tggtggtggtggtgcctctaatgggacaggctctggagctggacctaagattgaagaggttgactaagtttttgaaacattggttgtatgtgtatgaaac |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54395330 |
tggtggtggtggtgcatctaatgggacaggctctggagctggacctaagattgaagaggttgactaagtttttgaaacattggttgtatgtgtatgaaa- |
54395232 |
T |
|
| Q |
118 |
ttgtcttgtgtcctgttaatgttt-agttacagaaggtaggtaggcttgagtgtctaaggttttatat--gtctttttt-agttttgtgtgatcagtgta |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
54395231 |
---------gtcctgttaatgttttagttacagaaggtaggtaggcttgagtgtctaaggttttatatatgtctttttttagttttgtgtgatcagtgta |
54395141 |
T |
|
| Q |
214 |
attgagagatgaaataaaatgaatgcaatttaatttctgtcaatttatatcgcttaaatctgatactacctgctaagaggtggct |
298 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54395140 |
attgagagatgaaataaaatgaatgtaatttaatttctgtcaatttatatcgcttaaatctgatactacctgttaagaggtggct |
54395056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University