View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13140_low_25 (Length: 241)
Name: NF13140_low_25
Description: NF13140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13140_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 27801221 - 27801461
Alignment:
| Q |
1 |
ttatgtctattgcggagctcctatttctgctacttccaa-------cttaaattgtcctctttatacattgtttgtgactctggacagtcaaaactctgg |
93 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27801221 |
ttatgtctattgtggcgctcctatttctgctacttccaattttcaacttaaattgtcctctttatacattgtttgtgactctggacagtcaaaactctgg |
27801320 |
T |
 |
| Q |
94 |
gattgctgctttgtttagttttttcatgcagtgttaggtggtattagtttacccagttcttgtttctattttgaaactgaatcttattgttaggtggatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27801321 |
gattgctgctttgtttagttttttcatgcagtgttaggtggtattagtttacccagttcttgtttctattttgaaactgaatctcattgttaggtggatt |
27801420 |
T |
 |
| Q |
194 |
gtatgaatcttgaagttacatacataacatgccctttgctt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27801421 |
gtatgaatcttgaagttacatacataacatgccctttgctt |
27801461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University