View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13140_low_26 (Length: 237)
Name: NF13140_low_26
Description: NF13140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13140_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 106 - 167
Target Start/End: Original strand, 4391585 - 4391646
Alignment:
| Q |
106 |
gtactcttaatcttcctaaaatgatgctttttgtggaaaaactatatacatgaattaattcc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
4391585 |
gtactcttaatcttcctaaaatgatgctttttctggaaaaactatagacatgaattaattcc |
4391646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 4391972 - 4392019
Alignment:
| Q |
176 |
gggtagaatatacatgaattttaatttacattaagtgatggaaaatat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4391972 |
gggtagaatatacatgaattttaatttacattaagtgatggaaaatat |
4392019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 4391473 - 4391511
Alignment:
| Q |
1 |
attcattatattagatgatattgcaaatgaactagatgc |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4391473 |
attcattatattagatgatattgcaaatgaactagatgc |
4391511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University